Q information from the TB Systems Biology Consortium suggests that Rv0678 regulates the expression of more genes (41). We created extra probes to experimentally demonstrate binding of Rv0678 for the SIK3 Inhibitor Source promoter regions of mmpS2-mmpL2, mmpS4-mmpL4, and rv0991-0992.JOURNAL OF BIOLOGICAL CHEMISTRYStructure on the Transcriptional Regulator RvProbes are depicted schematically in Fig. 8a. We also saw concentration-dependent binding of Rv0678 to these two probes (Fig. 8b). As a control, EMSAs have been performed in the presence of non-labeled probes. Release of DIG-labeled probe was observed constant with precise binding of Rv0678 towards the rv0678-mmpS5, rv0505-mmpS2, and mmpL4 probes (Fig. 8c). Applying the sequence from the six probes that shifted, we identified a putative consensus binding sequence for Rv0678 using the MEME algorithm (17) (Fig. 8e). Rv0678 co-crystallized having a ligand whose binding renders the protein unable to bind DNA. The addition of 1-stearoyl-rac-glycerol (an isomer of 2stearoylglycerol) towards the EMSA reaction buffer lowered Rv0678 binding to a target promoter probe (Fig. 8c). Dye Primer-based DNase I Footprint Assay–To further refine the binding PARP Inhibitor web web-site of Rv0678 within the rv0678-mmpS5 intergenic region, a DNase I footprint assay was performed around the Rv0678-mmpS5 probe using established techniques (35). Electropherograms in Fig. 9 show the DNA sequence bound by Rv0678. The handle protein BSA did not lead to DNA protection at the same concentration. Interestingly, the area bound by Rv0678 involves the begin codon on the rv0678 gene (underlined nucleotides in Fig. 9b). The bound sequence includes a prospective inverted repeat motif (GAACGTCACAGATTTCA . . . N8 . . . TGAAACTTGTGAGCGTCAAC). Rv0678-DNA Interaction–A fluorescence polarizationbased assay was carried out to study the interaction amongst Rv0678 and also the 26-bp DNA containing the 18-bp putative promoter DNA sequence (TTTCAGAGTACAGTGAAA). Our footprint assay has suggested that this promoter DNA sequence was protected by the Rv0678 regulator. Fig. 10a illustrates the binding isotherm of Rv0678 within the presence of 5 nM fluoresceinated DNA. The titration experiment indicated that this regulator binds the 26-bp promoter DNA having a dissociation constant, KD, of 19.6 3.0 nM. The binding information also indicate that Rv0678 binds its cognate DNA with a stoichiometry of one Rv0678 dimer per dsDNA. Furthermore, fluorescence polarization was employed to establish the binding affinities of this 26-bp DNA by the Rv0678 mutants D90A and R92A. These two residues are situated inside the -hairpin of the winged helix-turn-helix motif of the N-terminal DNA-binding domain. In ST1710, the corresponding two residues are essential for regulator-promoter interactions. Interestingly, our measurements indicate that the KD values in the D90A-DNA and R92A-DNA complexes are 113.3 16.eight and 86.0 7.4 nM (Fig. 10, b and c), revealing that the DNA binding affinities for these mutants are substantially weaker than that on the native Rv0678 regulator. Like ST1710, our experimental outcomes recommend that residues Asp-90 and Arg-92 are important for DNA recognition. With the increasing incidence of drug resistant strains of M. tuberculosis, it can be increasingly vital to know the molecular mechanisms underlying virulence and drug resistFIGURE ten. Representative fluorescence polarization of Rv0678. a, binding isotherm of Rv0678 using the 26-bp DNA containing the 18-bp promoter sequence, displaying a KD of 19.6 three.0 nM. b, the bindin.